Cyclospora cayetanensis Protocol: Concentration and Preparation of Oocysts from Produce for the Polymerase Chain Reaction (PCR) and Microscopy

(Revised by FDA 9 June 97)

NOTE: This methodology is still evolving. Updates may be issued at any time. Laboratories unable to undertake the miscroscopic and PCR analyses should proceed with the wash method (Section II) and ship the wash sediment (1 ml supernatant plus pellet: Section II, Step 6) to a lab that can follow up. This works better than shipping the produce. Brand names and suppliers of reagents are provided as a convenience and comparable substitutions may be made. The use of brand names in this protocol does not constitute an endorsement of that product.

  1. Reagents & Materials
    1. Water

      1. Deionized Water (for washing produce)

      2. Sterile Deionized Water (for PCR)

    2. Glass Beads (Sigma #G-9139, TMS silicanized, 140-270 mesh).

    3. Sterile 1X TE, pH 7.4. (Digene catalog #3400-139 or equivalent product.)

    4. 50 ml Centrifuge Tubes (eg., 50 ml polypropylene centrifuge tubes with caps, Gibco #925-4900XT) or 250 ml centrifuge tubes (Sorvall Instruments #03939 or equivalent) depending on the centrifuge and rotor used. Reusable tubes are thoroughly washed in detergent, rinsed 5X (including at least 2X in deionized water) and drained.

    5. Epifluoresence Microscope equiped with a UV 1A filter block (Excitation Filter, EX 365/10; Dichroic mirror, DM 400; Barrier Filter, BA-400; or equivalent).

    6. GeneAmp PCR Core Reagent Kit II (Perkin Elmer Catalog #N808-0009) (no MgCl2)

      Components: AmpliTaq polymerase, 250 Units, 5U/microliter

      GeneAmp dNTPs, set of four, consists of dATP, dTTP, dGTP and dCTP, each vial containing 320 microliters of a 10 mM solution of the specified deoxynucleoside triphosphate.

      GeneAmp 10X PCR Buffer II, 1.5 ml, consisting of 500 mM KCl and 100 mM Tris-HCl, pH 8.3.

      MgCl2 solution, 1.5 ml, 25 mM

    7. Primers: CYCF1E, CYCR2B, CYCF3E and CYCR4B are described in Relman et al., (J. Infect. Dis. 173:440-445, 1996) and in Table 1. Primers can be commercially prepared (e.g. Midland Certified Reagent Co.), and the primers are stored at -20°C as a stock solution of 100 micromolar in deionized water. Prepare a working solution of 10 micromolar in sterile deionized water and store at -20°C (in a non-frostfree freezer if possible).

      Table 1: PCR Primer Sequences

      Primer Sequence (5' - 3') Use
      CYCF1E GGAATTCCTACCCAATGAAAACAGTTT 1st PCR - forward
      CYCR2B CGGGATCCAGGAGAAGCCAAGGTAGG 1st PCR - reverse
      CYCF3E GGAATTCCTTCCGCGCTTCGCTGCGT 2nd PCR - forward
      CYCR4B CGGGATCCCGTCTTCAAACCCCCTACTG 2nd PCR - reverse

    8. Agarose (SeaKem LE Agarose FMC BioProducts catalog #50004 or equivalent product).

    9. Ethidium Bromide (Sigma Chemical Co. catalog #E-8751 or equivalent product).

    10. 1X TBE.

      100 ml 10X TBE (Digene catalog #3400-1036 or equivalent product).

      900 ml deionized water.

    11. Gel Loading Buffer.

      1 ml Reconstituted Bromphenol blue-Xylene Cyanole Dye Solution (Sigma catalog #B-3269 or equivalent product).

      0.6 ml Sterile Glycerol (J.T. Baker Inc. catalog #4043-00 or equivalent product).

      qs to 2 ml with sterile deionized water.

    12. 100 bp Molecular Weight Ladder (BioMarker Low, BioVentures 101, catalog #M-1 or equivalent product).

    13. Polaroid Type 667 and Type 665 film. Polaroid Corporation, Cambridge, MA.

    14. Restriction Endonuclease Enzyme Mnl I

      (Amersham Life Sciences Inc., Arlington Heights, IL) comes with Buffer M (catalog #E0215Y)

    15. 4% Nusieve 3:1 agarose or GTG agarose ,FMC, Rockland, ME (catalog #50091 or #50081).

  2. Recovery of Oocysts
  3. Wash Method for Fresh Produce (Berries, Lettuce, ...) or Puree (For Vinaigrette, Proceed to Step 4)

    1. Prepare a ziplock or stomacher bag containing 250 ml of deionized water (Reagent #1).

    2. Add 250-500 grams of produce (berries +/- 1 berry; USE ONLY INTACT BERRIES, because the juice from cut or broken berries may be inhibitory to PCR and debris may interfere with microscopy). Use 250 grams of puree (because this consists of mashed berries, juice and debris are unavoidable).

    3. Agitate gently for 20 minutes by placing on a platform shaker set at 60 to 150 cycles per minute, depending on the condition of the produce (especially the berries). Invert the bag at 10 minutes to ensure thorough washing.

    4. Pour liquid suspension into the centrifuge tubes.

    5. Centrifuge the 50 ml tubes at 1500 X g for 10 minutes. Centrifuge the 250 ml tubes at 1500 X g for 20 minutes.

    6. Decant or aspirate supernatant and discard, leaving approximately 1 ml of supernatant and pellet fraction. If the 50 ml tubes are used for centrifugation, all pellet material and residual supernatant should be combined into one tube. The volume of the residual supernatant and pellet fraction varies, depending on the type and condition of samples, and the volume should be recorded. Appropriate aliquots will be removed from this tube for microscopy (Section III) and PCR (Section IV). The remaining portion should be stored at 4°C for up to one month. After one month, the remaining material should be diluted with an equal volume of 2.5% potassium dichromate, mixed and stored at 4°C.

    NOTE:

  4. Slide Preparation and Microscopic Analysis
  5. Cyclospora oocysts autofluoresce cobalt blue with the UV-1A emission filter or blue-green with broader emission spectra filters under ultraviolet illumination. Prepare slides in duplicate, and examine slides under ultraviolet illumination as described below.

    Laboratories should use a microscope reticle capable of measuring 8 - 10 micrometers to check on cyst size when organisms are recovered. Compare presumptive oocysts to those in a known standard.

    1. Slide Preparation
      1. Cover slip should be ringed with silicone vacuum grease.

      2. Apply 10 microliters of sediment to a clean glass slide and prepare a wet mount using the pre-greased cover slip.

    2. Microscopy
      1. Examine slide under UV light at 400 X. Cyclospora oocysts fluoresce. Check cyst size and compare to a standard.

      2. Switch from epifluorescence microscopy to bright field microscopy or differential interference contrast microscopy to confirm internal structures of presumptive Cyclospora oocysts. Recheck size and again compare to a standard.

      3. Presumptive positive results should be
        1. preserved by sealing the cover slips to the glass slides using fingernail polish, slide compound or paraffin wax,
        2. documented with photographs at multiple planes, and
        3. confirmed by an expert laboratory.

  6. PCR Analysis
    1. Template Extraction and Preparation:
      1. Remove 100 microliters of produce sediment prepared in Section II, Step 6 and transfer to a sterile cryo-microcentrifuge tube (Sarstedt #72.694.006 or equivalent tube should be screw capped and durable enough to withstand the freeze/thaw procedure). Remove the end of small bore pipet tips to facilitate pipeting of produce sediment.

      2. Centrifuge at 14,000 RPM (15,800 X g) for 3 minutes and discard supernatant.

      3. Wash the pellet once with 500 microliters of TE (Section I, Reagent #3) and centrifuge at 14,000 RPM for 3 minutes.

      4. Resuspend in 100 microliters TE (Section I, Reagent 3).

      5. Vortex to resuspend pellet, approximately 10-30 sec.

      6. Complete 3 freeze/thaw cycles, each 2 min. in liquid nitrogen or a dry ice-ethanol bath followed by 2 min in a 98°C waterbath.

      7. Add 0.1 +/- 0.02 g. glass beads (Sigma #G-9139) to extract.

      8. Agitate the suspension with a vortex mixer or thermomixer, set at full speed, for 5 minutes and then chill on ice for 5 minutes. A mixer attachment for holding multiple samples is useful at this step.

      9. Centrifuge sample extract at 14,000 RPM (15,800 X g) for 3 minutes.

      10. Transfer the supernatant to new sterile microcentrifuge tube. This extract can be stored frozen (-20°C) until ready for the PCR analysis, or if needed as reserve in the case of template inhibition problems.

      11. Combine 20 microliters of sample extract and 2 microliters of Non-fat Milk Solution (50 mg instant nonfat dried milk, [Janet Lee Brand or any food-grade equivalent] in 1 ml sterile deionized water, prepared fresh the day of the analysis). The entire 22 microliter volume will be used as template in a 100 microliter PCR amplification.

    2. PCR Conditions:
    3. Reagents: Perkin Elmer Kit II (no MgCl2 in 10X buffer)

      Primers: CYCF1E, CYCR2B, CYCF3E and CYCR4B are described in Relman et al., (J. Infect. Dis. 173:440-445, 1996) and in Table 1 (above). Primers can be commercially prepared (e.g. Midland Certified Reagent Co.), and the primers are stored at -20°C as a stock solution of 100 micromolar in sterile deionized water. Prepare a working solution of 10 micromolar in sterile deionized water and store at -20°C (in a non-frostfree freezer if possible).

      1. Prepare reaction mix as indicated in Table 2:

        Table 2: First PCR Reaction Components

        Component microliters Final concentration
        sterile deionized water 43.5
        10X PCR Buffer II 10.0 50 mM KCl, 10 mM Tris-HCl, pH 8.3
        dATP, dCTP, dGTP, dTTP 10 mM
        each dNTP mixed to give a final concentration of 2.5 mM
        8.0 200 micromolar each dNTP
        MgCl2; 25 mM 8.0 2.0 mM
        Primer CYCF1E (10 micromolar) 4.0 0.4 micromolar
        Primer CYCR2B (10 micromolar) 4.0 0.4 micromolar
        AmpliTaq polymerase, 5U/microliter 0.5 2.5 Units
        Template DNA 22 Sample extract prepared above

      2. Mix tubes by gently tapping and add 50 microliters (or 2 drops) sterile mineral oil if required by thermal cycler model.

      3. All PCR analyses should include positive and negative controls for each experiment. Positive control DNA template can be prepared by the extraction of DNA from Eimeria tenella or Cyclospora cayetanensis oocysts using the method described above. The positive control reaction should use extracted DNA equivalent to 25 to 50 oocysts as a template. In a separate reaction 20 microliters of produce extract spiked with extracted DNA equivalent to 25 to 50 oocysts should be included as a control for detecting inhibition by produce extracts. If inhibition by 20 microliters of produce extract is observed, a smaller volume (1 to 10 microliters) of the produce extract should be assayed in a attempt to overcome the inhibition (appropriate controls should be included).

      4. PCR cycling protocol is as shown in Table 3:

        Table 3: First PCR thermal cycling parameters

        Step Temperature/Duration
        Initial Inactivation/Denaturation: 1 cycle 94°C/3 min
        Amplification: 45 cycles
        Denaturation 94°C/30 sec
        Annealing 55°C/30 sec
        Extension 72°C/90 sec
        Final extension: 1 cycle 72°C/9 min
        Hold (until next PCR round) 4°C

      5. For the second round of PCR add 2 microliters of the first PCR product to 48 microliters of new reaction mix containing no template or test fraction. Refer to Table 4 for individual reaction components:

        Table 4: Second PCR Reaction Components

        Component microliters Final concentration
        sterile deionized water 30.75
        10X PCR Buffer II 5.0 50 mM KCl,
        10 mM Tris-HCl, pH 8.3
        dATP, dCTP, dGTP, dTTP 10 mM each dNTP mixed to give a final concentration of 2.5 mM 4.0 200 micromolar each dNTP
        MgCl2; 25 mM 4.0 2.0 mM
        Primer CYCF3E, 10 micromolar 2.0 0.4 micromolar
        Primer CYCR4B, 10 micromolar 2.0 0.4 micromolar
        AmpliTaq polymerase, 5U/microliter 0.25 1.25 Units
        Template DNA 2.0 From first PCR

      6. The second PCR cycling conditions are identical to the first except that the annealing temperature is 60°C.

    4. Gel Electrophoresis:
      1. Mix 10 microliters of the amplification product from the second round of PCR with 2 microliters gel loading buffer (0.25% bromphenol blue, 0.25% xylene cyanole and 30% glycerol or equivalent). If mineral oil has been used, wipe the pipet tip before mixing reaction material with loading buffer.

      2. Load the entire volume into a well of a 1.2% agarose gel prepared with Tris Borate EDTA (TBE) buffer and 0.5 micrograms/ml ethidium bromide. Alternatively the gel (without ethidium bromide) can be post stained for 15 minutes with ethidium bromide (1.0 microgram/ml) in TBE. A 100 bp ladder Molecular Weight marker (BioMarker Low, BioVentures 101, Murfreesboro, TN or equivalent) is very useful for distinguishing the 308 bp DNA amplification product, especially because primer-dependent material that is not Cyclospora DNA is visible at around 100 bp.

      3. Electrophorese the gel at 8-V/cm for approximately 1 hour.

      4. PCR products are visualized by UV transillumination and photographed using Polaroid Type 667 film. The predicted size after F1E/R2B, is 651 bp; after F3E/R4B is 308 bp. Note: The amplified product after the first round may not be visible; therefore, only product from the second round of PCR should be electrophoresed.

  7. Restriction Endonuclease Fragment Length Polymorphism (RFLP) Analysis of PCR Amplified Products:
    1. A PCR product of 308 bp after the second PCR round in the nested PCR is a presumptive positive for Cyclospora or Eimeria. The band pattern resulting from digestion of the amplification product with the restriction enzyme Mnl I can be used to distinguish between Cyclospora and Eimeria amplification products.

      Combine 10 microliters of amplification product from the second round of PCR with one unit of the restriction endonuclease enzyme Mnl I (Amersham Life Sciences Inc., Arlington Heights, IL) and 5 microliters 10X Buffer M supplied with the restriction enzyme and bring the final reaction volume up to 50 microliters with sterile deionized water.

      Prepare a separate restriction digest for each presumptive positive PCR amplification, and amplification products from control Cyclospora cayetanensis and Eimeria tenella strains. A digest including 1 microgram lambda DNA should also be prepared to demonstate complete digestion by the enzyme.

    2. Incubate the restriction digests 1 hr in a 37°C waterbath.

    3. Mix 10 microliters of each restriction endonuclease digest with 2 microliters of loading buffer (0.25% bromphenol blue, 0.25% xylene cyanole and 30% glycerol). Load the entire volume into a well on a 4% NuSieve 3:1 or GTG agarose (FMC, Rockland, ME) gel prepared with Tris Borate EDTA (TBE) buffer. Alternate lanes should contain a molecular size standard ladder (BioMarker Low, BioVentures 101, Murfreesboro, TN).

    4. Electrophorese the gel at 5 volts/cm for 3 hr or until the first dye front is approximately 1 cm from the end of the gel.

    5. Post-stain the gel in 1X TBE containing 1 microgram/ml ethidium bromide (Sigma Chemicals, St. Louis, MO) for 10 to 15 min and destain in deionized water for 1 to 5 min.

    6. Place the gel on a UV transilluminator and photograph with Type 667 (1 second at f4.5) and/or Type 665 film (50-60 seconds at f4.5). Develop the negatives from Type 665 film as per manufacturer's instructions (Polaroid Corp., Cambridge, MA).

    7. Acquire images by transmission densitometry from the Polaroid Type 665 film negatives with gel scanner (Sharp JX-325 with film scan unit or equivalent) as *.tif bitmap images (Adobe Photoshop v. 3.0 or equivalent). Gel analysis software (RFLPScan 3.0 (beta) Scanalytics Inc., Billerica MA or equivalent) can be used to analyze gels with user interactive algorithms for the band (peak) detection and relative peak area (% integrated optical density, OD) calculations. Band detection parameters of lane width of 39-29.66, band height threshold of 6-4, and smoothing operator pixel length of 2-50, allow for the automatic detection of all peaks. The molecular size standards are entered and properly associated with the standard peaks for the lanes containing the standards. The lanes are calibrated using the RFLPScan "de-smile" method with external lane standards and log piecewise linear regression. Band data may then be exported to a spreadsheet program (EXCEL 5.0, Microsoft, Redmond, WA or equivalent).

    The band position analysis can also be performed by measuring the band migration distances from the bottom of the gel wells to the nearest 0.25 mm with a ruler and using the SeqAid II program ver. 3.81 (D.J. Roufa, Manhattan, KS or equivalent), or generating a calibration curve by plotting the logarithm of the number of base pairs of each standard band versus the migration distance. Table 5 lists the predicted fragment sizes for Cyclospora and Eimeria amplified products, observed fragment sizes should be within 5% of the predicted bp sizes.

    Table 5: Predicted Restriction Endonuclease Mnl I Fragment Sizes.

    Predicted Fragment Sizes
    Organism Fragment 1 Fragment 2 Fragment 3
    Cyclospora sp. 146 114 48
    Eimeria sp. 132 114 62

  8. References
  9. Chambers, J., Somerfeldt, S., Mackey, L., Nichols, S., Ball, R., Roberts, D., Dufford, N., Reddick, A., Gibson, J. (1996). Outbreaks of Cyclospora cayetanensis infection -- United States, 1996. MMWR 45: 549-551.

    De Boer, S.H., Ward, L.J., Li, X., and Chittaranjan, S. (1995). Attenuation of PCR inhibition in the presence of plant compounds by addition of Blotto. Nuc. Acids Res. 23:2567-2568.

    Herwaldt, B.L., Ackers, M-L., and Cyclospora Working Group (1997). An outbreak of cyclosporiasis associated with imported raspberries. New England Journal of Medicine. May 29, 1997:1548-1556.

    Huang, P., Weber, J.T., Sosin, D.M., Griffin, P.M., Long, E.G., Murphy, J.J., Kocka, F., Peters, C. and Kallick, K.C. (1995). The first reported outbreak of diarrheal illness associated with Cyclospora in the United States. Ann. Intern. Med. 123: 409-414.

    Jackson, G.J., Leclerc, J.E., Bier, J.W. and Madden, J.M. (1997). Cyclospora - Still Another New Foodborne Pathogen. Food Technology 51:120.

    Jinneman, K.C., Wetherington, J.W., Adams, A.M., Johnson, J. M. Tenge, B.J., Dang, N.L. and Hill W.E. (1996). Differentiation of Cyclospora sp. and Eimeria spp. by Using the Polymerase Chain Reaction Amplification Products and Restriction Fragment Length Polymorphisms. FDA Laboratory Information Bulletin, 4044.

    Johnson, D.W., Pieniazek, N.J., Griffin, D.W., Misener, L. and Rose, J.B. (1995) Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts in water samples. Appl. Environ. Microbiol. 61: 3849-3855.

    Levine, N.D. (1985) Phylum II: Apicomplexa. In Illustrated Guide to the Protozoa, J.J. Lee, S.H. Hunter, and G.C. Boure, (eds.), Society of Protozoologist, Lawrence, KS, pp. 319-350.

    Noble, E.R., and Noble, G.A. (1971) Parasitology: The Biology of Animal Parasitology, 3rd ed., Lee and Febiger, Philadelphia. PA, pp. 84-86.

    Ortega, Y., Sterling, C.R., Gilman, R.H, Cama, V.A, and Diaz, F. (1993) Cyclospora species -- a new protozoan pathogen of humans. N. Engl. J. Med. 328: 1308-1312.

    Relman, D.A., Schmidt, T.M., Gajadhar, A., Sogin, M., Cross, J., Yoder, K.l., Sethabutr, O., and Echeverria, P. (1996) Molecular phylogenetic analysis of Cyclospora, the human intestinal pathogen, suggests that it is closely related to Eimeria species. J. Infect. Dis. 173:440-445.

    Roxas, C., Miller, N., Cabrera, L., Ortega, Y., Gilman, R., and Sterling, D. (1996) Vegetables as a potential transmission route for Cyclospora and Cryptosporidium. Abstracts of the Annual Meeting of the American Society for Microbiology, C-102, p.19.

    Yoder, K.E., Sethabutr, O., and Relman, D.A. (1996) PCR-based detect ion of the intestinal pathogen Cyclospora in PCR Protocols for Emerging Infectious Diseases, a supplement to Diagnostic Molecular Microbiology: Principles and Applications. D.H. Persing (ed.), ASM Press, Washington, DC, pp.169-176.


    Comments and questions on microscopy should be directed to Dr. Jeffrey W. Bier JWB@cfsan.fda.gov or for PCR to Dr. J. Eugene LeClerc J3L@cfsan.fda.gov or for RFLP to Karen C. Jinneman KJINNEMA@ora.fda.gov

    HTML last edited 25 June 1997 by mow@cfsan.fda.gov